RegulonDB RegulonDB 10.8: Gene Sequence
yahH gene sequence


Size: 321        A: 69  T: 67  G: 98  C: 87

Fasta

 

>yahH E. coli K12. Version NC_000913.3 GI:556503834
gtgaacgccttatccggcctacgaatggcgcaagaatctgtaggcctgataagcgtagcg
catcaggcatttgtcaccattgccggatgcggcgtgaacgccttatccggcctacgaatg
gcgcaagaatctgtaggcctgataagcgtagcgcatcaggcatttgccaccactgccgga
tgcggcgtggacgccttatccggcctacgagtggcgcgagaatctgtaggcctgataagc
gtagcgcatcaggcatttgtcaccattgccggatgcggcgtgaacgccttatccggccta
cgagtggcgcgagaattgtag
              
                            

Download fasta file
RegulonDB