RegulonDB RegulonDB 10.9: Gene Sequence
peaD gene sequence


Size: 312        A: 86  T: 67  G: 89  C: 70

Fasta

 

>peaD E. coli K12. Version NC_000913.3 GI:556503834
tacgagtattgccggaagcgtggcctgtatccggatgcagagtcttatccgtggaaatcg
aacgcgcattactggttggttaccaacttgtaccagaacatgcgggccaatgcgctggct
gacgcggaattacggcgcaaggctgccgatgaactgacctgtatgacagcgcgaattaac
cgtggtgagacgatacctgaaccagtaaaacaacttcctgttatgggcggtagacctcta
aatcgtgcacaggctctggcgaagatcgcagaaattaaagctaagttcggactgaaagga
gcaagtgtatga
              
                            

Download fasta file
RegulonDB