RegulonDB RegulonDB 10.9: Gene Sequence
icdC gene sequence


Size: 165        A: 48  T: 40  G: 47  C: 30

Fasta

 

>icdC E. coli K12. Version NC_000913.3 GI:556503834
atgctgcgccatatgggttggactgaagcggctgacctgattgttaaaggtatggaaggc
gcaatcaatgccaagaccgtaacttatgacttcgaacgtctgatggaaggcgctaagctg
ctgaaatgttcagagtttggtgaagcgatcatcgaaaacatgtaa
              
                            

Download fasta file
RegulonDB