RegulonDB RegulonDB 10.9: Gene Sequence
ysdC gene sequence


Size: 177        A: 45  T: 36  G: 56  C: 40

Fasta

 

>ysdC E. coli K12. Version NC_000913.3 GI:556503834
atgagtcagcaagtggcggtggaaaaactggtcgtggacgcctgggaacagcgttcatat
cagcacctgtggcaggcgattacgttgtcgaaaacggtaccgagcgcctcggtcgccaaa
gctattctggatgagttgctggaggccaacaaagcgtactggccagagttacgttaa
              
                            

Download fasta file
RegulonDB