RegulonDB RegulonDB 11.1: Gene Sequence
insM gene sequence


Size: 259        A: 79  T: 60  G: 61  C: 59

Fasta

 

>insM E. coli K12. Version NC_000913.3 GI:556503834
atgagcagaaaaacccaacgttactctaaaaagttcaaagccgaagctgtcagaacggtt
cttgaaaatcaactttcgatcagtgaaggcgcttcccgattatctcttcctgaaggcact
ttaggacaatgggttaccgccgccagaaaagggctcggtactcctggttcccgcacggtg
gctgaactggaatctgaaattctgcaactgcgtaaggcgttaaatgaagctcgccttgag
cgagatatattaaaaaaag
              
                            

Download fasta file
RegulonDB