RegulonDB RegulonDB 10.9: Gene Sequence
rseX gene sequence


Size: 91        A: 11  T: 48  G: 17  C: 15

Fasta

 

>rseX E. coli K12. Version NC_000913.3 GI:556503834
tttttattattctgtgtcatgatgcttccgttattagccttttatcgtcttgtttatatt
ttttgggccggcatgatgccggctttttttt
              
                            

Download fasta file
RegulonDB