RegulonDB RegulonDB 10.9: Gene Sequence
ylcI gene sequence


Size: 195        A: 72  T: 38  G: 40  C: 45

Fasta

 

>ylcI E. coli K12. Version NC_000913.3 GI:556503834
atgtcaactaagaacagaacccgcagaacaacaacccgcaacatccgctttcctaaccaa
atgattgaacaaattaacatcgctcttgagcaaaaagggtccgggaatttctcagcctgg
gtcattgaagcctgccgtcggaggctaacgtcagaaaagagagcatatacatcaattaaa
agtgatgaagaatga
              
                            

Download fasta file
RegulonDB