RegulonDB RegulonDB 11.1: Gene Sequence
rydC gene sequence


Size: 65        A: 9  T: 24  G: 15  C: 17

Fasta

 

>rydC E. coli K12. Version NC_000913.3 GI:556503834
cttccgatgtagacccgtattcttcgcctgtaccacgggtcggttttagtacaggcgttt
tctt
              
                            

Download fasta file
RegulonDB