RegulonDB RegulonDB 10.10: Gene Sequence
ydgU gene sequence


Size: 84        A: 13  T: 35  G: 16  C: 20

Fasta

 

>ydgU E. coli K12. Version NC_000913.3 GI:556503834
atggtgggccgttatcgctttgagttcattctgatcatccttattttatgcgcactgatt
accgcccgtttttatctttcctga
              
                            

Download fasta file
RegulonDB