RegulonDB RegulonDB 10.9: Gene Sequence
yojO gene sequence


Size: 165        A: 50  T: 49  G: 37  C: 29

Fasta

 

>yojO E. coli K12. Version NC_000913.3 GI:556503834
atgcataccccgatcggggtaaaacctgtagcaggatcaaaagagtggcgggaagcgtgg
caaaaacgggcttttgctcacatttcaaatggttataaatatatttatatagcgattgat
tcaccagagatatttctgctggtttgctctctcattagaatttaa
              
                            

Download fasta file
RegulonDB