RegulonDB RegulonDB 10.9: Gene Sequence
ypaB gene sequence


Size: 144        A: 46  T: 37  G: 37  C: 24

Fasta

 

>ypaB E. coli K12. Version NC_000913.3 GI:556503834
atgaccctcttgcaagtgcataactttgtggataactcaggaaggaaaaagtggctttcg
cgcaccttaggtcagacaaggtgtccgggaaagtcaatgggaagagaaaaatttgttaaa
aataactgttcggcgatttcttga
              
                            

Download fasta file
RegulonDB