RegulonDB RegulonDB 10.10: Gene Sequence
ryfB gene sequence


Size: 319        A: 86  T: 91  G: 72  C: 70

Fasta

 

>ryfB E. coli K12. Version NC_000913.3 GI:556503834
cgttattgaagattttgctgtgctttacaccatgccacagaattcccccattgaaacgag
tggtgtcgtcaaagctctggtgtggagtgcagcatgcaccctcaataactcgcacgttca
gttttggggagatgtaagggctaatctgaatggctgcattccttgtttaaggaaaaacga
atgactgattgccgatacctgattaaacgggtcatcaaaatcatcattgctgttttacag
ctgatccttctgttcttataacacaaggaaacgtacttaaggtgcgtccggtgaaccagt
cggacgcacctttaataac
              
                            

Download fasta file
RegulonDB