RegulonDB RegulonDB 10.9: Gene Sequence
ryfD gene sequence


Size: 143        A: 37  T: 48  G: 30  C: 28

Fasta

 

>ryfD E. coli K12. Version NC_000913.3 GI:556503834
aatcaagacgatccggtacgcgtgattttcttttcacattaatctggtcaataaccttga
ataattgagggatgacctcatttaatctccagtagcaactttgatccgttatgggaggag
ttatgcgtctggatcgtcttact
              
                            

Download fasta file
RegulonDB