RegulonDB RegulonDB 10.9: Gene Sequence
ygdT gene sequence


Size: 147        A: 40  T: 45  G: 32  C: 30

Fasta

 

>ygdT E. coli K12. Version NC_000913.3 GI:556503834
atgttatccacagaaagctgggataactgtgaaaaacctccactactgtttccatttaca
gccttgacgtgcgacgaaactccagtttttagtggttcagtgcttaacttagtggcacat
tctgtggataaatacggcattggttga
              
                            

Download fasta file
RegulonDB