RegulonDB RegulonDB 10.9: Gene Sequence
ykfL gene sequence


Size: 222        A: 40  T: 60  G: 64  C: 58

Fasta

 

>ykfL E. coli K12. Version NC_000913.3 GI:556503834
attatcgccattgttgtcatcgtcatcattctgaacaaaaccggggtgtccgacagtctc
gcggccctgacccttgccactgttgccgcactgctgacgggaggtggcgcagccggtgct
gccagtgtcgcgctgacaccgttcgtcggcgtgccggtgggtattttcgtgggcatttat
gtctttgccaaagtggttcgtctgatttcaggaaaaaaataa
              
                            

Download fasta file
RegulonDB