RegulonDB RegulonDB 10.9: Gene Sequence
ykfK gene sequence


Size: 192        A: 34  T: 46  G: 67  C: 45

Fasta

 

>ykfK E. coli K12. Version NC_000913.3 GI:556503834
atgacacaggcagaacgccgccatgaccggctggctgtcaggctgtcactgataatcagc
cgtctggtggcaggggaaacgctgagtgtgcgtaagcttgccgctgagtttggtgtgtcg
gtgcgcacgctgcggcgtgattttcgtgagcggctgatgtatctggacctggagtatcag
tccggatattgc
              
                            

Download fasta file
RegulonDB