RegulonDB RegulonDB 10.9: Gene Sequence
sgrT gene sequence


Size: 132        A: 33  T: 37  G: 35  C: 27

Fasta

 

>sgrT E. coli K12. Version NC_000913.3 GI:556503834
atgcgtcagttttatcagcactattttaccgcgacagcgaagttgtgctggttgcgttgg
ttaagcgtcccacaacgattaaccatgcttgaaggactgatgcagtgggatgaccgcaat
tctgaaagttga
              
                            

Download fasta file
RegulonDB