RegulonDB RegulonDB 10.9: Gene Sequence
ibsC gene sequence


Size: 60        A: 16  T: 23  G: 10  C: 11

Fasta

 

>ibsC E. coli K12. Version NC_000913.3 GI:556503834
atgatgcgacttgtcatcatactgattgtactgttactcataagtttcagcgcttattaa
              
                            

Download fasta file
RegulonDB