RegulonDB RegulonDB 10.9: Gene Sequence
shoB gene sequence


Size: 81        A: 22  T: 29  G: 13  C: 17

Fasta

 

>shoB E. coli K12. Version NC_000913.3 GI:556503834
atgactgattgccgatacctgattaaacgggtcatcaaaatcatcattgctgttttacag
ctgatccttctgttcttataa
              
                            

Download fasta file
RegulonDB