RegulonDB RegulonDB 10.10: Gene Sequence
yoeI gene sequence


Size: 63        A: 18  T: 17  G: 16  C: 12

Fasta

 

>yoeI E. coli K12. Version NC_000913.3 GI:556503834
atggggcaattttttgcttacgcgacggttatcaccgtaaaggagaatgaccatgtcgca
taa
              
                            

Download fasta file
RegulonDB