RegulonDB RegulonDB 10.9: Gene Sequence
yobI gene sequence


Size: 66        A: 23  T: 30  G: 5  C: 8

Fasta

 

>yobI E. coli K12. Version NC_000913.3 GI:556503834
atgtatatttttattacgcatttcttcactgaatatgtaatattaaaatatttgcttcca
atataa
              
                            

Download fasta file
RegulonDB