RegulonDB RegulonDB 10.9: Gene Sequence
ymjD gene sequence


Size: 66        A: 24  T: 18  G: 13  C: 11

Fasta

 

>ymjD E. coli K12. Version NC_000913.3 GI:556503834
atgaaacatattcaaatccgcaatagtgatatggactggcatattgctgccaataatctg
ggataa
              
                            

Download fasta file
RegulonDB