RegulonDB RegulonDB 10.9: Gene Sequence
ynbG gene sequence


Size: 66        A: 34  T: 23  G: 3  C: 6

Fasta

 

>ynbG E. coli K12. Version NC_000913.3 GI:556503834
atgaaatatataaattgtgtatataatataaattacaaattaaaaccacattctcattat
aaataa
              
                            

Download fasta file
RegulonDB