RegulonDB RegulonDB 10.9: Gene Sequence
yoaJ gene sequence


Size: 75        A: 22  T: 21  G: 23  C: 9

Fasta

 

>yoaJ E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaaacaacgattattatgatgggtgtggcgattattgtcgtactcggcactgag
ctgggatggtggtaa
              
                            

Download fasta file
RegulonDB