RegulonDB RegulonDB 10.9: Gene Sequence
yoaK gene sequence


Size: 99        A: 19  T: 38  G: 24  C: 18

Fasta

 

>yoaK E. coli K12. Version NC_000913.3 GI:556503834
atgcgaatcggtattatttttccggttgtaatcttcattacagcggtcgtatttttagca
tggttttttattggcggctatgctgccccgggagcataa
              
                            

Download fasta file
RegulonDB