RegulonDB RegulonDB 10.9: Gene Sequence
yohP gene sequence


Size: 84        A: 21  T: 34  G: 20  C: 9

Fasta

 

>yohP E. coli K12. Version NC_000913.3 GI:556503834
atgaaaattatactctgggctgtattgattattttcctgattgggctactggtggtgact
ggcgtatttaagatgatattttaa
              
                            

Download fasta file
RegulonDB