RegulonDB RegulonDB 10.9: Gene Sequence
ykgR gene sequence


Size: 102        A: 36  T: 37  G: 14  C: 15

Fasta

 

>ykgR E. coli K12. Version NC_000913.3 GI:556503834
atgaaagagaataaagtacagcaaatcagtcataaactgattaatatcgttgtttttgtc
gcaattgtagaatacgcctatttatttctccatttctattaa
              
                            

Download fasta file
RegulonDB