RegulonDB RegulonDB 10.9: Gene Sequence
mgrR gene sequence


Size: 98        A: 28  T: 29  G: 20  C: 21

Fasta

 

>mgrR E. coli K12. Version NC_000913.3 GI:556503834
gattcgttatcagtgcaggaaaatgcctgttagcgtaaaagcaaaacacaaatctatcca
tgcaagcattcaccgccggtttactggcggtttttttt
              
                            

Download fasta file
RegulonDB