RegulonDB RegulonDB 10.9: Gene Sequence
fnrS gene sequence


Size: 122        A: 25  T: 43  G: 28  C: 26

Fasta

 

>fnrS E. coli K12. Version NC_000913.3 GI:556503834
gcaggtgaatgcaacgtcaagcgatgggcgttgcgctccatattgtcttacttccttttt
tgaattactgcatagcacaattgattcgtacgacgccgactttgatgagtcggcttttt
              
                            

Download fasta file
RegulonDB