RegulonDB RegulonDB 10.9: Gene Sequence
ykgQ gene sequence


Size: 129        A: 37  T: 46  G: 30  C: 16

Fasta

 

>ykgQ E. coli K12. Version NC_000913.3 GI:556503834
gatttctcactgacagataaagaaatggcacaaattagttcgcttgatttgggttatgtt
ggggagtcggtaaaacattttaatcctgaatttgttcgtggttgtcttgctgtaaaaata
catgattga
              
                            

Download fasta file
RegulonDB