RegulonDB RegulonDB 10.9: Gene Sequence
eyeA gene sequence


Size: 75        A: 16  T: 17  G: 20  C: 22

Fasta

 

>eyeA E. coli K12. Version NC_000913.3 GI:556503834
tctatcacgcttgcgttgctgacttctgccaacttgcggcaagcaaggataaagagtgcg
acgggcagcctcctc
              
                            

Download fasta file
RegulonDB