RegulonDB RegulonDB 10.9: Gene Sequence
null gene sequence


Size: 188        A: 46  T: 57  G: 48  C: 37

Fasta

 

>null E. coli K12. Version NC_000913.3 GI:556503834
tgcgcatcagtaataaatgacacacagcaaaatgaatccgtttatttgggtacttataat
cctgatgacgctagacgcgctgcgggaattggctggcgcttcgtctattttaggatggct
attaacgttggtttgagctggcaataagtccggacgggtatttaccgcagtccggactta
tttttcag
              
                            

Download fasta file
RegulonDB