RegulonDB RegulonDB 10.10: Gene Sequence
null gene sequence


Size: 241        A: 85  T: 67  G: 51  C: 38

Fasta

 

>null E. coli K12. Version NC_000913.3 GI:556503834
cgatatatgtttattttatgtaaaatcaatttatgtaaaaagtcacatcattgtagttaa
aaaggttgagttagatcgcagaaacgggtacatatagccccgcaaacgtgaccacgcccg
cagatattacttaaatcagagccatagaggccacgcaggcgaggcatcaatctttacgat
ctgtataaagacggattgttgatgatgtgttaaaattgatgtaaacaaattgtgaagtga
a
              
                            

Download fasta file
RegulonDB