RegulonDB RegulonDB 10.9: Gene Sequence
nc1 gene sequence


Size: 168        A: 59  T: 50  G: 31  C: 28

Fasta

 

>nc1 E. coli K12. Version NC_000913.3 GI:556503834
acaggaggaaacgtggtgtatttaaatatggggtaactctttgattttaatggtgccgat
aataggagtcgaacctacgaccttcgcattacgaatgcgatgttaatgcatttttaacta
cttgagcaatcaatcaaaacaacatactttatattataaaacaccaag
              
                            

Download fasta file
RegulonDB