RegulonDB RegulonDB 10.9: Gene Sequence
micL gene sequence


Size: 80        A: 15  T: 28  G: 15  C: 22

Fasta

 

>micL E. coli K12. Version NC_000913.3 GI:556503834
atttttaccgttgcatcatgtcgcccaatatgatgcttgctcgtaccaggcccctgcaat
ttcaacaggggccttttttt
              
                            

Download fasta file
RegulonDB