RegulonDB RegulonDB 10.9: Gene Sequence
ryeG gene sequence


Size: 194        A: 55  T: 56  G: 55  C: 28

Fasta

 

>ryeG E. coli K12. Version NC_000913.3 GI:556503834
ttggttctggagggggtttgttgtgggcaatgatgcatttaagttatcgtctgcagatag
aggagatattacaataaacaacgaatcagggcatttgatagtcaataccgcaattctatc
aggagatatagtcactctaagaggaggagaaattaggttggtattatagcttgtgcgcgc
catgattggcgcgc
              
                            

Download fasta file
RegulonDB