RegulonDB RegulonDB 10.9: Gene Sequence
yoeH gene sequence


Size: 159        A: 52  T: 43  G: 41  C: 23

Fasta

 

>yoeH E. coli K12. Version NC_000913.3 GI:556503834
gcactcttgacataagagtgcggtccgtggaaaacggagttgaaaaaatggtgtctgaaa
gaaggtaccatcattgtgatgacaaatactttggcgtggataatgtaattaattgctgaa
attgaccgtatatgcggtaagactcatatcagtatcagg
              
                            

Download fasta file
RegulonDB