RegulonDB RegulonDB 10.9: Gene Sequence
yoeG gene sequence


Size: 533        A: 157  T: 155  G: 119  C: 102

Fasta

 

>yoeG E. coli K12. Version NC_000913.3 GI:556503834
atggttatttaacttctcagcaccactaatgatcctgagcaacttcgtatttgggccatt
accatggagtagaaagctgtgtctgagaatgcagaatttgagaaaagaattcgctttctt
ggagagcttctgaaaatggcacgctaacaacgttttgttaaaaaatgtgaatcacttgcc
ggggctgcattttctattcgaggagaatgttgacgtagatattacagaaatctcagcgca
tcaggataaactgctaccttaggtcaaccaccaaaagaaaatacaatacgtccagtttgt
atgcctttaataacacatcttctaaatgttgaagaattatcccgcctgctgaagaacgtt
gctctgagtgtgataaacctttttattcttgatgatgtcagcgagaagatggaatatatc
cccgactgggtcgtggttacccggttaaacatctggtggcgctaataaatctggcaagtc
acattctgttgaatgctgtgacagtgccttaccgagagagcgaaattgtggtg
              
                            

Download fasta file
RegulonDB