RegulonDB RegulonDB 10.9: Gene Sequence
yeeH gene sequence


Size: 87        A: 21  T: 30  G: 16  C: 20

Fasta

 

>yeeH E. coli K12. Version NC_000913.3 GI:556503834
tgcatagtcgccaccattccggataattctattacgttgttttacaagttcttttacagc
gcagatctgtcgctgacgttgaatcaa
              
                            

Download fasta file
RegulonDB