RegulonDB RegulonDB 10.9: Gene Sequence
ttcC gene sequence


Size: 51        A: 27  T: 8  G: 8  C: 8

Fasta

 

>ttcC E. coli K12. Version NC_000913.3 GI:556503834
atgtcgcaaaatcaagaaattagtaagaaagaacaatacaacctgaacaag
              
                            

Download fasta file
RegulonDB