RegulonDB RegulonDB 10.10: Gene Sequence
mokA gene sequence


Size: 185        A: 55  T: 60  G: 43  C: 27

Fasta

 

>mokA E. coli K12. Version NC_000913.3 GI:556503834
tactcgttggaaatcaacacaggaggctgggaatgccgcagaaatatagattactttctt
taatagtgatttgtttcacgcttttatttttcacctggatgataagagattcactgtgtg
aattgcatattaaacaggagagttatgagctggcggcgtttttagcctgcaaattgaaag
agtaa
              
                            

Download fasta file
RegulonDB