RegulonDB RegulonDB 10.9: Gene Sequence
ymiB gene sequence


Size: 105        A: 35  T: 38  G: 17  C: 15

Fasta

 

>ymiB E. coli K12. Version NC_000913.3 GI:556503834
atgacttacatgaaattaacggcggctaaacgcattgttttttttatatatttatttgta
atccagttttggaaaaacgccagttttcaaacgaaagtcagttaa
              
                            

Download fasta file
RegulonDB