RegulonDB RegulonDB 10.9: Gene Sequence
ykgS gene sequence


Size: 129        A: 32  T: 42  G: 34  C: 21

Fasta

 

>ykgS E. coli K12. Version NC_000913.3 GI:556503834
atgagaatgattggccttctttatgattttaaggattatgcttctaaaatggcggagaac
atggcgaggcttgctgccttacttcattacttcagcggtgatggaggcgatatatctgtt
accgggtaa
              
                            

Download fasta file
RegulonDB