RegulonDB RegulonDB 10.9: Gene Sequence
rzoQ gene sequence


Size: 255        A: 77  T: 52  G: 61  C: 65

Fasta

 

>rzoQ E. coli K12. Version NC_000913.3 GI:556503834
atgcgcaacagaaatctgctgaaatttctgccagggctgcttatctgtctgatagtgtta
accagttgcgtgccgaagcaaaaaaatatgccatacgccttgacgcagcgaagcataccg
cagatcttgccgctgccgtcagaggcaaaacaaccaaaaccgccgaaggaatgctcacca
acatgctcggagatattgcagcagaagctcagctttatgctgaaattgctgacgaacgct
acatcgcaggagtga
              
                            

Download fasta file
RegulonDB