RegulonDB RegulonDB 10.10: Gene Sequence
insI2 gene sequence


Size: 174        A: 65  T: 38  G: 37  C: 34

Fasta

 

>insI2 E. coli K12. Version NC_000913.3 GI:556503834
gagaacacaaatgggctaattcggcagtactttcctaaaaagacatgtcttgcccaatat
actcaacatgaactagatctggttgctgctcagctaaacaacagaccgagaaagacactg
aagttcaaaacaccgaaagagataattgaaaggggtgttgcattgacagattga
              
                            

Download fasta file
RegulonDB