RegulonDB RegulonDB 11.1: Gene Sequence
pspH gene sequence


Size: 111        A: 33  T: 31  G: 19  C: 28

Fasta

 

>pspH E. coli K12. Version NC_000913.3 GI:556503834
gataatcaaatctgtcactattgcgcctctaacagattcatcgtgctgtaccctacatac
agccgaactataaaaagaaagggcttcccaggtggaagccctatttctttta
              
                            

Download fasta file
RegulonDB