RegulonDB RegulonDB 10.10: Gene Sequence
gndA gene sequence


Size: 165        A: 39  T: 47  G: 42  C: 37

Fasta

 

>gndA E. coli K12. Version NC_000913.3 GI:556503834
atgctgctattgattccctcaaaccatatctcgataaaggagacatcatcattgatggtg
gtaacaccttcttccaggacactattcgtcgtaatcgtgagctttcagcagagggcttta
acttcatcggtaccggtgtttctggcggtgaagagggggcgctga
              
                            

Download fasta file
RegulonDB