RegulonDB RegulonDB 10.9: Gene Sequence
ymcF gene sequence


Size: 189        A: 48  T: 53  G: 39  C: 49

Fasta

 

>ymcF E. coli K12. Version NC_000913.3 GI:556503834
attactcaacatctccatttccgctgtccatgttgtcatggttcacagtaccgcacatcg
gcattcgatgtgacggagcgaaaccctttgggcgctaagtgtattttttgtaaatcgacg
atgatcacctttgataacgtcgcgctgcaaatacgcactgaccatgcgccgctggatttc
acaaaataa
              
                            

Download fasta file
RegulonDB