RegulonDB RegulonDB 10.9: Gene Sequence
ynfQ gene sequence


Size: 189        A: 57  T: 68  G: 31  C: 33

Fasta

 

>ynfQ E. coli K12. Version NC_000913.3 GI:556503834
attacaaaccatattcactttagatgcccgtgttgtcatggttcccagtatagaacatca
tcttttgatgtttctgacatgaatcctttcggggcaaaatgtatcttttgtaaatcaatg
atgattacatttgataatatttcacaatacttaaatgccagccgtctgtcgttggattta
aaaaagtga
              
                            

Download fasta file
RegulonDB