RegulonDB RegulonDB 10.9: Gene Sequence
ybfI gene sequence


Size: 150        A: 40  T: 39  G: 38  C: 33

Fasta

 

>ybfI E. coli K12. Version NC_000913.3 GI:556503834
atccggcagatgtagggtctaaacgcgatcgaacacagcaactatttgcgtaattatatg
gggcatctgcgacaaaaactggaacaggatccggcccggcctcgccattttattactgaa
accggtattgggtatcggtttatgctttga
              
                            

Download fasta file
RegulonDB